96
|
Revvity
ivis spectrum in vivo imaging system Ivis Spectrum In Vivo Imaging System, supplied by Revvity, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/IVIS+optical+imaging+platform/10__1158_slash_0008___5472__can___19___2288-64-6-12 Average 96 stars, based on 1 article reviews
ivis spectrum in vivo imaging system - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
99
|
Thermo Fisher
housekeeping gene glyceraldehyde 3 phosphate dehydrogenase Housekeeping Gene Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/Phosphate/pm20108057-33-19-43 Average 99 stars, based on 1 article reviews
housekeeping gene glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
90
|
AUTODOCK GmbH
vina 1.1.2 software Vina 1.1.2 Software, supplied by AUTODOCK GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/vina+1+1+2+software/pmc07699345-156-14-13 Average 90 stars, based on 1 article reviews
vina 1.1.2 software - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
91
|
OriGene
n a 50 nd1 qpcr ctagcagaaacaaaccgggc quiros N A 50 Nd1 Qpcr Ctagcagaaacaaaccgggc Quiros, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/MT+ND1+(ND1)+Human+qPCR+Primer+Pair/pm37541209-216-47-65 Average 91 stars, based on 1 article reviews
n a 50 nd1 qpcr ctagcagaaacaaaccgggc quiros - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
90
|
Bio-Quant inc
bioquant nova prime software Bioquant Nova Prime Software, supplied by Bio-Quant inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/bioquant+nova+prime+software/pmc06622016-150-35-39 Average 90 stars, based on 1 article reviews
bioquant nova prime software - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
97
|
Revvity
ivis spectrum Ivis Spectrum, supplied by Revvity, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/Living+Image+Software/ppr0218141-115-10-25 Average 97 stars, based on 1 article reviews
ivis spectrum - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
96
|
Addgene inc
rplpo forward primer Rplpo Forward Primer, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/gRNA_Cloning+Vector+(Plasmid+%2341824)/pm28388431-228-34-30 Average 96 stars, based on 1 article reviews
rplpo forward primer - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
99
|
Psychology Software Tools
e prime 3 0 software E Prime 3 0 Software, supplied by Psychology Software Tools, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/E-Prime/pmc12477440-134-24-27 Average 99 stars, based on 1 article reviews
e prime 3 0 software - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
96
|
GE Healthcare
probequant g 50 micro columns Probequant G 50 Micro Columns, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/illustra+ProbeQuant+G-50+Micro+Columns/pmc07391607-1549-91-95 Average 96 stars, based on 1 article reviews
probequant g 50 micro columns - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
90
|
PRIMER-E
permanova Permanova, supplied by PRIMER-E, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/permanova/10__3390_slash_agronomy10030333-113-7-10 Average 90 stars, based on 1 article reviews
permanova - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
91
|
Thermo Fisher
gene exp naa50 hs00363889 m1 Gene Exp Naa50 Hs00363889 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/Gene+Exp%2E+NAA50%2C+Hs00363889_m1/10__7554_slash_elife__29702-458-49-47 Average 91 stars, based on 1 article reviews
gene exp naa50 hs00363889 m1 - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
96
|
MACHEREY NAGEL
nucleospin rna ii Nucleospin Rna Ii, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/prime+5%2E0+software/NucleoSpin+RNA+%2F+Protein%2C+Mini+kit+for+RNA+and+protein+purification/pm19620648-31-26-31 Average 96 stars, based on 1 article reviews
nucleospin rna ii - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |